Posts
6118
Following
0
Followers
28
Displays only the finest of trash taken from /r/copypasta
I have an obsession with burly black men
Show content
I love watching big black bulky men shaking their ass cheeks. Often when they do so I also like to see their long and majestic dick dwindling between their muscular legs. It turns me on so much to be honest. I jerk off each time I see black men. I can't stop it. I do it at least 3 times every day. When I do so, I like to imagine them shoving up their absolute beast of a cock penetrating my little virgin anus. They would take their dick out only to see it covered in tons of blood and shit residue that's too deep inside the anal cavity to be completely wiped. Honestly I am going crazy without a black man by my side. When I grow up I want to become a personal slut for a dominant BBC male. I want to feel his cock. I want to feel his seed overflowing from my ass and pouring down on the floor and the sheets. Even in my underwear, really. Last but not least I want to deepthroat a nigger so much. Holy fuck I want him to choke me for at least 20 seconds so I can feel like I am dying because of cock, which I love oh-so much. I want the semen to be directly deposited into my throat so I physically can't spit it out. I want to swallow all of it. I am so fucking horny for a big black cock right now. I'm going to jerk off to black men right now. See ya!
0
0
0
Bosnia Wikipedia But in Bosnian
Show content
Bosna i Hercegovina (skraćeno BiH, neformalno Bosna, ćirilica Босна и Херцеговина) suverena je država u jugoistočnoj Evropi, smještena na zapadu Balkanskog poluostrva. Na sjeveru, zapadu i jugozapadu graniči s Hrvatskom, na istoku sa Srbijom, a na jugoistoku s Crnom Gorom. Pomorska je država jer na jugu, na teritoriji općine Neum, izlazi na Jadransko more. Glavni i najveći grad države jest Sarajevo. Nezavisnost je stekla 1. marta 1992. nakon odluke građana referendumom o samoopredjeljenju. Prema rezultatima popisa stanovništva iz 2013, imala je 3.531.159 stanovnika.
0
0
0
Frankenstein's monster
Show content
I couldn't help but notice you referred to Frankenstein. I must say, as a lover of literature and a stickler for accuracy, I find this mistake quite appalling.

Frankenstein, as I'm sure you're aware (or at least I hope you are), is actually the name of the scientist who created the monster. Therefore, the monster should be referred to as Frankenstein's monster, not Frankenstein.

I understand that some may find this to be a trivial matter, but as someone who values intellectual discourse and precision in language, I simply cannot let this slide. I implore you to take the time to educate yourself on the nuances of Mary Shelley's masterpiece, and to use proper terminology when discussing it in the future.

And Frankenstein’s monster did die in the end (as did Frankenstein himself) so your post is entirely meaningless.
0
0
0
Sisters’ perspective
Show content
During my childhood my brother was always there for me. We are only two years apart, me being the younger of us two. Whenever I didn’t know what to do or started crying in public he would take my hand and lead us to our parents. We were best friends that hung out all the time and did everything together. As we grew up he seemed to be shutting me out more so every year though. He started opting to stay in his room by himself and play games instead of asking me to play some co-op games with him. He even started to talk less and less with our parents with a disconnected look that seemed to growing even more disinterested with every day. Did I do something wrong? Did something happen to him? I tried asking at one point but he looked so annoyed and like he wanted nothing more than to get out of me confronting him, so I laid off him. We went to the same school for a couple of years before he graduated. I had a healthy amount of friends in most classes, got good grades, and was even a captain of the tennis team. I didn’t do anything for anybody but to help my own case, but I thought maybe he would see me doing well and that would spark something. That something would ignite in my brother and bring back the old and reliable person that I reluctantly admit that I missed. That never took over a large amount of my headspace, it was a hope I had, not an expectation. After he graduated from high school he moved out and didn’t visit very much. He went to college for a couple years before dropping out. He went from job to job for a while before most employers in our small town knew about his bad working reputation. The look in his eyes looked ever more distant still with each day. He hasn’t worked in over 2 years now and still has yet to open up to me or my parents. He lives alone about 10 minutes from me and almost never leaves his house. He’s extremely pale and thin after being cooped up for so long. I really don’t want to take care of this guy after our parents pass…
0
0
0
I want sex so fucking bad
Show content
I want sex so fucking bad

I wish i could be promiscuous and have a big dick and make all women orgasm fuck fuck i can’t because i’m genetic trash anyway lol fuck fuck fuck fuck fuck

I NEED SEX I NEED SEX I NEED SEX DEAR LORD WHY WAS I BORN SO FUCKING INFERIOR TO OTHER MEN JUST KILL MEEEEEEE
0
0
0
AITA for Sharing my Passion for Criminal Justice With the Babysitter?
Show content
It was a typical Friday Night. I (33 M) just got home from work. Pop some pizza bites in the microwave and log into my Rig. First thing's first: open up reddit and check my latest post to r/justiceserved.

"Wait... Jarvis - pause on this screen" 4000 updoots? Nice. I took a long time choosing a title and it payed off: "Careful, He's a Hero: this 16 year old boy just shredded off his uncle's testacles with a cheese grater when he found out they don't believe in the Death Penalty for pedophiles" (i.e. wholesome)

And then in walks the GF (28 F). "You're watching that torture stuff again?!" She's upset, but it's hardly new. "torture stuff" lol. I roll my eyes, but otherwise stay patient and just remind myself that not everyone is as passionate about criminal justice as myself.

Don't worry, it gets worse. "Why did you just make pizza bites? Our dinner reservation is in an hour." Oh brother. I try to explain that my latest post went viral (i.e. epic) so I'll need to spend the evening at home, adding edits / updates if necessary. She just scoffs and tells me the babysitter will be coming over to watch Jen (i.e. our newborn daughter) and that she's going out to dinner without me. "kay, bye." Doesn't even look back. Doesn't even care to mention my recent success on r/justiceserved.

Wife heads to dinner, and the babysitter's already over - putting Jen to bed in the other room. She eventually joins me by my rig to ask what I'm doing. Explain that I'm just going viral on Reddit, NBD. But what's this? She's actually interested, wants to know more. It's nice to meet someone like minded, so naturally I get carried away. Ask her if it would be ok if I show her my viral criminal justice post while I maybe finger her asshole (i.e. epic and wholesome). Oh... she says nah (classic bait and switch), storms out.

Hour later, the Wife comes home. She's upset, says she just spoke to the sitter and "knows what I said." Lol what??? So it's a crime now to share my passion for criminal justice I guess.

Anyway, what digs Reddit? AITA for caring about Criminal Justice?
0
0
0
the how world was created history
Show content
so um based on my calculations exactly 69 billion years and 42 seconds ago earth started existing so um not also earth but sun and sunlar system startes existing so um i think that is very awesome so um when there was nothing in existingance so um then was a white dot so um it became big so um it is um so um it became the universe and so um then um was um stars that um overheated the nothingness so um earth appeared so um The history of Earth concerns the development of planet Earth from its formation to the present day.[1][2] Nearly all branches of natural science have contributed to understanding of the main events of Earth's past, characterized by constant geological change and biological evolution.

The geological time scale (GTS), as defined by international convention,[3] depicts the large spans of time from the beginning of the Earth to the present, and its divisions chronicle some definitive events of Earth history. (In the graphic, Ma means "million years ago".) Earth formed around 4.54 billion years ago, approximately one-third the age of the universe, by accretion from the solar nebula.[4][5][6] Volcanic outgassing probably created the primordial atmosphere and then the ocean, but the early atmosphere contained almost no oxygen. Much of the Earth was molten because of frequent collisions with other bodies which led to extreme volcanism. While the Earth was in its earliest stage (Early Earth), a giant impact collision with a planet-sized body named Theia is thought to have formed the Moon. Over time, the Earth cooled, causing the formation of a solid crust, and allowing liquid water on the surface.

The Hadean eon represents the time before a reliable (fossil) record of life; it began with the formation of the planet and ended 4.0 billion years ago. The following Archean and Proterozoic eons produced the beginnings of life on Earth and its earliest evolution. The succeeding eon is the Phanerozoic, divided into three eras: the Palaeozoic, an era of arthropods, fishes, and the first life on land; the Mesozoic, which spanned the rise, reign, and climactic extinction of the non-avian dinosaurs; and the Cenozoic, which saw the rise of mammals. Recognizable humans emerged at most 2 million years ago, a vanishingly small period on the geological scale.

The earliest undisputed evidence of life on Earth dates at least from 3.5 billion years ago,[7][8][9] during the Eoarchean Era, after a geological crust started to solidify following the earlier molten Hadean Eon. There are microbial mat fossils such as stromatolites found in 3.48 billion-year-old sandstone discovered in Western Australia.[10][11][12] Other early physical evidence of a biogenic substance is graphite in 3.7 billion-year-old metasedimentary rocks discovered in southwestern Greenland[13] as well as "remains of biotic life" found in 4.1 billion-year-old rocks in Western Australia.[14][15] According to one of the researchers, "If life arose relatively quickly on Earth … then it could be common in the universe."[14]

Photosynthetic organisms appeared between 3.2 and 2.4 billion years ago and began enriching the atmosphere with oxygen. Life remained mostly small and microscopic until about 580 million years ago, when complex multicellular life arose, developed over time, and culminated in the Cambrian Explosion about 538.8 million years ago. This sudden diversification of life forms produced most of the major phyla known today, and divided the Proterozoic Eon from the Cambrian Period of the Paleozoic Era. It is estimated that 99 percent of all species that ever lived on Earth, over five billion,[16] have gone extinct.[17][18] Estimates on the number of Earth's current species range from 10 million to 14 million,[19] of which about 1.2 million are documented, but over 86 percent have not been described.[20] However, it was recently claimed that 1 trillion species currently live on Earth, with only one-thousandth of one percent described.[21]

The Earth's crust has constantly changed since its formation, as has life since its first appearance. Species continue to evolve, taking on new forms, splitting into daughter species, or going extinct in the face of ever-changing physical environments. The process of plate tectonics continues to shape the Earth's continents and oceans and the life they harbor.
so um based on my calculations i wrote this all by myself without using um wikipedia🤓🤓🤓🤓🤓🤓🤓🤓🤓🤓🤓🤓🤓🤓🤓🤓🤓🤓🤓🤓🤓🤓🤓🤓🤓🤓🤓🤓🤓🤓🤓🤓🤓🤓🤓🤓🤓🤓🤓🤓🤓🤓🤓🤓🤓🤓 🤓🤓🤓🤓🤓🤓🤓🤓🤓🤓🤓🤓🤓🤓🤓🤓🤓🤓🤓🤓🤓🤓🤓🤓🤓🤓🤓🤓🤓🤓🤓🤓🤓🤓🤓🤓🤓🤓🤓🤓🤓🤓🤓🤓🤓🤓🤓🤓🤓🤓🤓🤓🤓🤓🤓🤓🤓🤓🤓🤓🤓🤓🤓🤓🤓🤓🤓🤓🤓
0
0
0
I LOVE CATGIRLS
Show content
HOLY MOLY I LOVE CATGIRLS SOOOO MUCH!!!! DAWG I GO TO SLEEP AT NIGHT PRETENDING MY IKEA PILLOWS ARE CATGIRLS!!!! THEN I PROCEED TO PRETEND THE EDGES OF THE PILLOWS ARE LIKE A CATGIRL'S EARS AND MASSAGE THEM TENDERLY WITH LOVE!!!!! I SNUGGLE WITH THEM EVERY EVENING AND IT MAKES ME FEEL WHOLESOME INSIDE!!!! I!!!! LOVE!!!!! CATGIRLS!!!!!!!
0
0
0
CS:GO Investor
Show content
Hey bro, This sounds like a great joke idea, and I'm always up for a good based joke! Based investors are always looking for unique, unconventional investment opportunities that can maximize their returns. This is exactly the kind of scheme that could appeal to them. First, we need to convey how our scheme is different and appealing, so it stands out among other MLM's. We can capitalize on the demand for MLM's, while presenting something original that no other MLM has done before. To do this we could: • Use quick analogies to describe our idea • Paint a crystal clear visualization of what our MLM looks like, and how it can improve the world • Make sure our pitch is very concrete and refrain from using vague buzzwords or description • Explain something unique about our MLM services that no other MLM can offer • Target our pitch to an older, based, men investor persona As long as we adhere to these rules, our pitch has the potential to be highly successful among based investors. Ultimately, it's a great opportunity to make profit off of something that can potentially spread like wildfire and make a positive difference in the world. Let me know if you need help expanding upon the idea, or if you need help with presentation and formatting. I'm here to help!
0
0
0
The Shit List
Show content
The Shit List:


The Ghost Shit


The kind where you feel shit come out, see shit on the toilet paper, but there's no shit in the bowl.




The Clean Shit


The kind where you feel shit come out, see shit in the bowl, but there's no shit on the toilet paper.




The Wet Shit


You wipe your ass fifty times and it still feels unwiped. So you end up putting toilet paper between your ass and your underwear so you don't ruin them with those dreadful skid marks.




The Second Wave Shit


This shit happens when you've finished, your pants are up to your knees, and you suddenly realize you have to shit some more.




The Brain Hemorrahage Through Your Nose Shit


Also known as "Pop a Vein in Your Forehead Shit". You have to strain so much to get it out that you turn purple and practically have a stroke.




The Corn Shit


No explanation necessary.




The Lincoln Log Shit


The kind of shit that's so enormous you're afraid to flush it down without first breaking it up into little pieces with the toilet brush.




The Nororius Drinker Shit


The kind of shit you have the morning after a long night of drinking. It's most noticeable trait is the tread mark left on the bottom of the toilet bowl after you flush.




The "Gee, I Really Wish I Could Shit" Shit


The kind where you want to shit, but even after straining your guts out, all you can do is sit on the toilet, cramped and farting.




The Wet Cheeks Shit


Also known as the "Power Dump". That's the kind that comes out of your ass so fast that your butt cheeks get splashed with the toilet water.




The Liquid Shit


That's the kind where yellowish-brown liquid shoots out of your butt, splashes all over the side of the toilet bowl and, at the same time, chronically burns your tender poop-chute.




The Mexican Food Shit


A class all on its own.




The Crowd Pleaser


This shit is so intriguing in size and/or appearance that you have to show it to someone before flushing.




The Mood Enhancer


This shit occurs after a lengthy period of constipation, thereby allowing you to be your old self again.




The Ritual


This shit occurs at the same time each day and is accomplished with the aid of a newspaper.




The Guinness Book Of Records Shit


A shit so noteworthy it should be recorded for future generations.




The Aftershock Shit


This shit has an odour so powerful than anyone entering the vicinity within the next seven hours is affected.




The "Honeymoon's Over" Shit


This is any shit created in the presence of another person.




The Groaner


A shit so huge it cannot exit without vocal assistance.




The Floater


Characterized by its floatability, this shit has been known to resurface after many flushings.




The Ranger


A shit which refuses to let go. It is usually necessary to engage in a rocking or bouncing motion, but quite often the only solution is to push it away with a small piece of toilet paper.




The Phantom Shit


This appears in the toilet mysteriously and no one will admit to putting it there.




The Peek-A-Boo Shit


Now you see it, now you don't. This shit is playing games with you. Requires patience and muscle control.




The Bombshell


A shit that comes as a complete surprise at a time that is either inappropriate to shit (i.e. during lovemaking or a root canal) or you are nowhere near shitting facilities.




The Snake Charmer


A long skinny shit which has managed to coil itself into a frightening position - usually harmless.




The Olympic Shit


This shit occurs exactly one hour prior to the start of any competitive event in which you are entered and bears a close resemblance to the Drinker's Shit.




The Back-To-Nature Shit


This shit may be of any variety but is always deposited either in the woods or while hiding behind the passenger side of your car.




The Pebbles-From-Heaven Shit


An adorable collection of small turds in a cluster, often a gift from God when you actually can't shit.




Premeditated Shit


Laxative induced. Doesn't count.




Shitzopherenia


Fear of shitting - can be fatal!




Energizer Vs. Duracell Shit


Also known as a "Still Going" shit.




The Power Dump Shit


The kind that comes out so fast, you barely get your pants down when you're done.




The Liquid Plumber Shit


This kind of shit is so big it plugs up the toilet and it overflows all over the floor. (You should have followed the advice from the Lincoln Log Shit.)




The Spinal Tap Shit


The kind of shit that hurts so much coming out, you'd swear it's got to be coming out sideways.




The "I Think I'm Giving Birth Through My Asshole" Shit


Similar to the Lincoln Log and The Spinal Tap Shits. The shape and size of the turd resembles a tall boy beer can. Vacuous air space remains in the rectum for some time afterwards.




The Porridge Shit


The type that comes out like toothpaste, and just keeps on coming. You have two choices: a) flush and keep going, or b) risk it piling up to your butt while you sit there helpless.




The "I'm Going To Chew My Food Better" Shit


When the bag of Doritos you ate last night lacerates the insides of your rectum on the way out in the morning.




The "I Think I'm Turning Into A Bunny" Shit


When you drop lots of cute, little round ones that look like marbles and make tiny splashing sounds when they hit the water.




The "What The Hell Died In Here?" Shit
Also sometimes referred to as "The Toxic Dump".

Of course you don't warn anyone of the poisonous bathroom odour. Instead, you stand innocently near the door and enjoy the show as they run out gagging and gasping for air.




The "I Just Know There's A Turd Still Dangling There" Shit


Where you just sit there patiently and wait for the last cling-on to drop off because if you wipe now, it's going to smear all over the place.
0
0
0
Told chat gpt to generate a house
Show content
/\
/ \
/ \
/______\
/| |\
/_|______|_\
// \\\
//| o o |\ \\
// | - | \\\
// | \___/ | \\\
// | | \\\
// |________| \\\
// \\\
// \\\
// \\\
// \\\
//______________________________\\\
|____________________________________|
0
0
0
Asking god for ice cream
Show content
Last week I took my children to a restaurant. My six-year-old son asked if he could say grace. As we bowed our heads he said, "God is good. God is great. Thank you for the food, and I would even thank you more if mom gets us ice cream for dessert. And Liberty and justice for all! Amen."

Along with the laughter from the other customers nearby, I heard a woman remark, "That's what's wrong with this country. Kids today don't even know how to pray. Asking God for ice-cream!"

Hearing this, my son burst into tears and asked me, "Did I do it wrong? Is God mad at me?"

As I held him and assured him that he had done a terrific job and God was certainly not mad at him, an elderly gentleman approached the table. He winked at my son and said, "I happen to know that God thought that was a great prayer." "Really?" my son asked. "Cross my heart."

Then in a theatrical whisper he added (indicating the woman whose remark had started this whole thing), "Too bad she never asks God for ice cream. A little ice cream is good for the soul sometimes."

Naturally, I bought my kids ice cream at the end of the meal. My son stared at his for a moment and then did something I will remember the rest of my life. He picked up his sundae and without a word walked over and placed it in front of the woman. With a big smile he told her...

"Here, this is for you. Ice cream is good for the soul sometimes, and my soul is good already.
0
0
0
Hey man, do I come down to the dick sucking factory and correct you?
Show content
Hey man, do I come down to the dick sucking factory and correct you? No I don't but if I did you'd be so fucking out of a job you'd join the shitting yourself factory. So don't come on here and correct me on arbitrary stuff. But yeah you probably right. Honestly I don't know anything about my mom's sex life. I might not even be hers. How would I know right? Anyway have fun down at the factory tomorrow. Job security is important these days. I hear you're up for a promotion.
0
0
0
boris johnson
Show content
OI OI OI!

​

⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⡀⠀⠀⠀⠀⠀

⠀⠀⠀⠀⠀⠀⠀⠀⠀⢠⣠⣾⣷⣿⣿⣿⣷⣄⠄⠀⠀⠀⠀⠀⠀⠀⠀
⠀⠀⠀⠀⠀⠀⠀⠀⣀⣾⣿⣿⣿⣿⣿⣿⣿⣿⣷⣦⢅⠀⠀⠀⠀⠀⠀⠀⠀⠀
⠀⠀⠀⠀⠀⠀⢀⣾⣿⣿⣿⣿⣿⣿⣿⣿⣿⣿⣿⣿⣷⡄⡀⠀⠀⠀⠀⠀⠀⠀
⠀⠀⠀⠀⠀⠀⣼⣿⣿⣿⣿⣿⣿⣿⣿⣿⣿⣿⣿⣿⣿⣿⡗⠀⠀⠀⠀⠀⠀⠀
⠀⠀⠀⠀⠀⣾⣿⣿⣿⣿⣿⣿⣿⣿⣿⣿⣿⣿⣿⣿⣿⣿⣿⡆⠀⠀⠀⠀⠀⠀
⠀⠀⠀⠀⠀⠘⢿⣿⠁⣩⣿⣿⣿⠿⣿⡿⢿⣿⣿⣿⠛⣿⡟⠀⠀⠀⠀⠀⠀⠀
⠀⠀⠀⠀⠀⠀⠀⢷⣾⣿⣋⡡⠤⣀⣷⣄⠠⠤⣉⣿⣷⣽⠀⠀⠀⠀⠀⠀⠀⠀
⠀⠀⠀⠀⠀⠀⠀⠈⣿⣿⣿⣿⣿⣿⣿⣿⡻⣾⣿⣿⣿⡟⠀⠀⠀⠀⠀⠀⠀⠀
⠀⠀⠀⠀⠀⠀⠀⠀⠙⣿⣟⢋⣰⣯⠉⠉⣿⢄⠉⢻⡟⠀⠀⠀⠀⠀⠀⠀⠀⠀
⠀⠀⠀⠀⠀⠀⠀⠀⠀⠹⣿⢿⣷⣶⠤⠔⣶⣶⠿⢾⣧⠀⠀⠀⠀⠀⠀⠀⠀⠀
⠀⠀⠀⢀⡀⠠⠀⠂⠀⠀⣧⡚⢿⣿⡶⢶⡿⠟⣠⣿⣿⠀⠀⠀⠀⠄⣀⡀⠀⠀
⠒⠒⠋⠁⠀⠀⠀⠀⠀⠀⢿⣷⣄⡀⠀⠀⠀⣈⣴⣿⣿⠀⠀⠀⠀⠀⠀⠀⠉⠒
⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⢸⣿⣿⡿⠒⠐⠺⣿⣿⣿⣿⠀⠀⠀⠀⠀⠀⠀⠀⠀
⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⢸⢿⣋⣀⡄⠠⣢⣀⣩⣛⠇⠀⠀⠀⠀⠀⠀⠀⠀⠀

​

WOTS ALL THIS???

​

🇬🇧🇬🇧🇬🇧

​

YER POISTIN LOICENSE HAS EXPOIRED!!!! 🇬🇧🇬🇧🇬🇧🇬🇧

​

ONE HUNNIT TESCO CLUBCARD POINTS 'AVE BIN DEDUCTED FROM YER ACCOUN'!!!!! 🇬🇧🇬🇧🇬🇧🇬🇧🇬🇧🇬🇧

​

YER THREE QUID MEAL DEAL IS GONNA BE A FIVER FROM NOW ON!!!! 🇬🇧🇬🇧🇬🇧🇬🇧🇬🇧

​

YER WILL ALSO ONLY BE ABLE TER CHOOSE FROM A CHICKEN OR 'AM SANDWICH!!!! 🇬🇧🇬🇧🇬🇧🇬🇧🇬🇧🇬🇧🇬🇧

​

FAILURE TO RENEW YER LOICENCE IS GONNA RESUL' IN THA LOSS OV MORE CLUBCARD POINTS!!!!!!!! 🇬🇧🇬🇧🇬🇧🇬🇧🇬🇧🇬🇧🇬🇧🇬🇧🇬🇧🇬🇧

​

🇬🇧🇬🇧🇬🇧🇬🇧🇬🇧🇬🇧🇬🇧🇬🇧🇬🇧🇬🇧🇬🇧🇬🇧🇬🇧🇬🇧
0
0
0
Anyone else watching fox news rn? Trump just went on to give statement, pulls his pants down, and poops right onto the table. And then Sean Hannity says 'Uh, sir, isn't there anything you want to add?' and the Trump lets out a huge shart and viewers at home see poop specs fly into the camera.
Show content
As Trump leaves the camera pans back to Sean Hannity who says 'there you have it folks, witch hunt'
0
0
0
Andrew Tate's confession
Show content
Having sex with a vagina is for absolute pussies. You know what a real man does? As a real gangsta myself, I take it in the ass. That's what real Gs do with their bros. I'll tell you something: I may be known as "Top G" in public, but here in my cell in Romania, I'm known as the "Bottom G". That's how we roll. I cannot think of a lower ROI activity than sticking your dick in pussy; it's a complete waste of time and energy. Just think about it for a second. Them hoes have taken literally millions of cock; it just ain't tight enough for me. But drilling a fellow G's ass, now that is a completely different story. Not only are you providing loads of stimulus for your penis, you're actively expanding your network by mingling with like-minded people. It's all part of making it into the top. That is ladies and gentlemen, the secret to escaping the matrix.
0
0
0
i wanna fuck hk416
Show content
Ahem, fellow gamers, may I have your attention, please? Today I've made the realization that I want to fuck hk416 from the video game Girls Frontline, she's so lascivious and sexy that I almost had sexual intercourse with my real-life hk416 gun, but I didn't want to clean all of my semen after so I didn't. Something about her magnificent shape and size makes me concupiscent.I have almost 40TB of HK416 hentai on my computer, I can't get hard on real-life women anymore since I pretty much don't masturbate to real porn.
0
0
0
Ladies And Gentlemen I Present To You: The Navy Seal Copypasta In DNA
Show content
ATGCGTACTTAGAGCTAGCGTCTAAGCGCTGATTCATCGAGCTACCTGTACAGCGACTGTGATAGCTGCGATTGATAGAGCGCTGATTCATCGCTGCTCGTCAGCTGAACTGACAGCACTCATTGTGATTAGAGCACACTAAGCGACTGTGATAGCATCCTGTAGTAGATCCTAAGCCATCTGTAGTCACGTAGCCTGATCATCAGCCGTACTGTACTAAGCGACTGTGATAGCTCGCTCTGTATGAGCCTGAGCGTCCACACTTACGATACTTAGCTATACAGCTAGTGTGAGAGCTGTGCTAGCACAGACAGCTCAATCACTTGATGAAGCCTGCTCAGCTAGCGTCTAAGCCTCACTGTAGACAGCTGACTAACTATCTGAAGCACTCTCTACAGCCTGGTACTAAGCCATCTACTACTCAGCCTGCTCGTATGTATCGTACTATACAGCCTGCTCAGCCTCGATACACTACACTGTGATTGAAGCTGACTATCACACCTATAGAGCCACACTCTGTACTGAAGCTGTCTCAGCACTATCTATGATACTCTATACACTAGCACTCTCTACAGCCTGAGCCGTACTGTACTAAGCTGTGTACTACACAGCGTGATAATAAGCTCATGTCTCGCTCTGCACACACTATACAGCTCGCTGATCATCTGAACGAGCCTGAGCACTACAAGCTAGCACACTCTGCTCCTATACAGCCTGCTCAGCGTCTGTCACCTGATCATCACTAGCATGACTCACGCTACTCACCTAAGCACTCTCTACAGCCTGACAAGCTAGCGTCTAAGCTAGTGTGAGAGCTGACTCCTGGAGCTACACAGCCTGCTCAGCTAGCGTCTAAGCCTACTCTAGCTGCACCTAAGCGATTGAAGCACTCACACACTATACAGCGCTTGTCACTCACTATGAACGAGCGACTGTGATAGCACTCACCTAAGCCTCTGTTAGCGTCTGCTCGTCAGCTAGTGTAGCACACTAAGCCATGATTAGAGCTGCGATTGATAGAGCACTCTCTGTTAGCGTCTACACAGCTAGACTCACGTCCTATAGACGAGCCTGAGCATGCTGATCATCAGCATGCTGGAGCTAAGCGACTGTGATAGCTAGCGTCTAAGCGCTGATTCATCGAGCTGTGATTAGAGCATGCTGTAGCGTAGCGAGCACCTATCACTGTGACTGTGTCTCAGCTAGCGTCTAAGCATCCTGTCGCTATGAAGCTGTGCTAGCATGCGTCTGTCACGTAGCCGTACTTGAAGCCTCCTAGTACTACACAGCCATCTACTACTCAGCTGACTACTACTCAGCCATCTAGCTTGTCACCTAAGCTGTCTCAGCTAGCGTCTGTGAAGCCTAACTCACTAGCGTAGCACAACTCACTCGAGCACAGACAGCGCTGATTCATCGCTGCTCGTCAGCATGTGTCACTACTGAACGAGCGACTGTGATAGCTAGCGTCTGCTCTCGAGCGACTGTGATAGCTCAACTCTCAGCGTCCTATAGAGCACTATGACTGACAGCATGCTGTAGCGTAGCTGAACTGACCTGCTCGTCAGCTAGCGTACTTAGAGCTGACGTCTGTAGAGCTAGTGTAGCACACTAAGCTGTGTACTACACAGCTAGCGTCTAAGCCTGCTCTAGCTACACCTCCTATAGAGCTAGCGTCTGCTCTCGAGCACTGTCACTCTGCTCAGCGCTGATTCATCGCTACACACGAGCACTTGAAGCATGCTAAGCTGAGAGCTAACTTCGAGCCTGAGCACTACAAGCTCATGTCTCTAGACTTCATAGCTGCTCGTCAGCACAGACAGCTGACTATCACACCTATAGAGCCTCCTATAGATGTGTCACTCGAGCTGTGCTAGCTGAGAGCTGCTATGAAGCACTTCACACTGTTGATGAAGCTAGCGTCTAAGCGATTGAACTAGCACTCTCTACAGCGACTGTGATCACAGCCTGGAGAGCCTGTGAAGCCATCTACTGCTCGTCAGCTAGCACACTTCACTATACAGCCACCTGGTCCGTTAGAGCCTCTGTATGAGCTGATGTAGCGACTGTGATAGCCATCTATAGTAGCTACACAGCGAGCACCTAGAGACTCACCTAAGCGCTTGTCACAGCTAGCGTCTAAGCTGATAGTGTCACACAAGCACAACTGTCGTCTGTTAGACGAGCTAGCGTCTAAGCTGATAGTGTCACACAAGCTAGCGTACTTAGAGCATGCTGGAGCTATGAAGCTGTGATTAGAGCTAGCGTCTAAGCGAGACTTAGCGTCTATAGCTGTCAAGCATCCTGTAGTAGATCCTAAGCTAGCGTCTGCTCGTCAGCGACTGTGATAGCTCAACTATCATCAGCGACTGTGATCACAGCATCCTGGCTCTAACGAGCGACTGTGATCACCTAAGCGCTGATTCATCGCTGCTCGTCAGCTACCTAACTTACAGCTCGCTGTACACGAGCCTGAGCTCAACTCTCAGCCATCTAAGCACTCTCGACATGCGTCTACACCTAAGCACTCTCGACTAGCTGACACTAAGCACTCTCTACAGCCTGAGCTCAACTCTCAGCTCGCTGATCATCAGCGACTGTGATAGCCTGCTCAGCTGTGTACTACACAGCTGACTAGTACTACTCAGCCGTGATCTCTACCACCTATACAGCATGACTGACTGAAGCACTCTCTACAGCTAGCGTACTTAGTGAAGCTGCGATTGATAGAGCATGCTGTAGCGTAGCACAGACAGCCATACTCACCTAAGCCGTACTCTCTACTGAACGAGCCTCTGTTAGAGCTGTCTCATCGACAGCACTACAAGCCTGAGCCTAAGTTAGCTACTCTGACTGGTACTAATCGACAGCTAGCACACTCTGCTCCTATACAGCCTGCTCAGCGATCTCACTCACACACTATACAGCTCATGTACACATACTTAGAGCCATGATTAGAGCCTGAGCCGTACTGTACTAAGCACTTCATCACTATGATGAAGCTAGTGTAGCTAGCGTCTAAGCCTACTCTAGCTGCACCTAAGCACTCACTGACTACTCACTATCAGCTGTGCTAGCTAGCGTCTAAGCGATCTCCTGTAGCTATACAGCTGATAGACTTAGCTATGAAGCACAACTCACCTGCTCCTAAGCTCATGTCACGAGTGAAGCACTCTCTACAGCCTGAGCATGCTGATCATCAGCGATTGACTAAGCCTGTAGAGCTAGTGTAGCCTGTAGTGAAGCGCTGATATCATCAGCCTAAGTTAGCTACTCTAGAGCTAGTGTAGCATGCTGGAGCTAAGCGACTGTGATCACAGCACACTGTGACTACACACTCATATCCTAAGCACTTGATGAAGCTGTGCTGCTAGCTAGCGTCTAAGCGCTACTTCACTAAGCTGTGCTAGCTAGCGTCTAAGCTCATGTCTCTAGCTGCTCCTACTCTAGAGCGACTGTGATAGCATCCTGTAGTAGATCCTAAGCTGACGTCTGTAGACGAGCCTGGCTAGCTGTCTCATCGACAGCGACTGTGATAGCTCATGTGATATCTACAGCCGTACTGTACTAAGCTCGCTCTGTATGCTCAGCATGCGTACTTAGAGCGATCTCCGTTGTATCGACAGCCACCTATAGCACCTGCATGATTAGCTGTGTCTCAGCGACTGTGATCACAGCATCCTGTAGTAGATCCTAAGCTCAATCCTAGTACTACACAGCTCATGTACAACACTACTCTAGAGCATGACTTGAAGCACTCATTGTGATTAGAGCTAGTGTAGCCATCACCTGCTCGTCAGCTACTGTATGCTCAGCGATGAGTGTCTCAGCGACTGTGATAGCACAACTGACCATCTAAGCGACTGTGATAGCATGTGTGATATCTACAGCCGTACTGTACTAAGCCGTCTAATCTACAGCGACTGTGATCACAGCGCTGATTCATCGCTGCTCGTCAGCTAGTGTCTCGTCGATCTAACGAGCCATGATTAGAGCGACTGTGATAGCTCATGTGATATCTACCTCTAGAGCGACTGTGATAGCTACCTGTACCTCTAGAGCACTCTCTACAGCCTCTGTATGAGCGACTGTGATCACCTAAGCGAGACTGACCTGCTCGTCAGCTAGCGTCTAAGCGAGCACCTGTCACTAAGCGACTGTGATAGCGTCTGTTACTACACTACACTCAGCCTGTACCTGTGTTAGACGAGCCTGAGCATGCTGATCATCAGCTGACGTCTGTAGAGCGCTGATCACGACAGCACTATCATCAGCTGTGTACTACACAGCGACTGTGATAGCACTCTCTACAGCGACTGTGATAGCATGCTGATCATCAGCTACCACTGTATGCTCAGCCTGCTCAGCCTGTAGACGAGCGACTGTGATCACCTAAGCGCTGATTCATCGCTGCTCGTCAGCTACCTAACTTACAGCTCGCTGTACTACTGTACG
0
0
0
Monosodium glutamate
Show content
Hitler used an flavor enhancer to kill Jews, and poison Polish prisoners, it is called Monosodium glutamate or just e621

Learn more about it on the forum about the flavor enhancer called e621.net and type in "adolf_hitler" into the search bar

It will ask you if you are over 18 as some images may be very brutal
0
0
0
A deleted post from No Stupid questions: What if aliens gangbanged an astronaut on Mars?
Show content
If we landed on mars and an astronaut stepped out of the rocket, and was subsequently gangbanged by several aliens who also had the ability to concurrently keep the astronaut alive during and after the process, would the US take action against these life forms? Or would they just let them get away with it?
0
0
0
Show older